How Do I?

...identify a short nucleotide fragment and determine its corresponding protein sequence?

Question

What is the corresponding protein sequence for this 25bp rat nucleotide sequence: GCGAGCCCACATGTTAATTGACATG?

Steps

Things to do

POINT your browser to the UCSC Genome Bioinformatics website.

SELECT Blat (BLAST-like alignment tool) from the list in the left column.

COPY the sequence listed above and PASTE into the BLAT search box.

From the dropdown menu under Genome SELECT ìRatî.

CLICK Submit.

You will be taken to a new page showing the BLAT Search Results. CLICK browser.

Results from the most recent rat genome assembly will be displayed. You will see a lot of information.To identify the protein associated with the nucleotide sequence of interest, under Genes and Gene Prediction Tracks, SELECT ìfullî or ìpackî from the dropdown menu for Known Genes, RefSeq Genes, and Other RefSeq.

CLICK the refresh button underneath the main display window.

Result

The main window will display the RefSeq Genes for your sequence of interest (if known) and a number of listings for Non-Rat RefSeq Genes in addition to UCSC Known Genes Based on UniProt, RefSeq, and GenBank mRNA.
SELECT the RefSeq Genes link to go to a corresponding organism-specific information page for the fragile X mental retardation syndrome 1 homolog (Fmr1).
From Links to sequence, SELECT ìPredicted Proteinî to go to the protein sequence and associated RefSeq name.

Keywords