|
Locating Gene-centric Information
This workshop will introduce a variety of databases and tools for genetic information retrieval, including:
-
HSLS Molecular Biology search system: search.HSLS.MolBio provides quick access to the major bioinformatics databases, software tools, and related literature on the Web, in addition to HSLS-supported license-based resources
- NCBI Entrez search system:
- GenBank: an annotated collection of all publicly available DNA sequences
- Refseq: a comprehensive, non-redundant set of sequences for DNA, RNA, proteins, etc.
- Gene: a database for gene-specific information
- OMIM: a catalog of human genes and genetic disorders
- HomoloGene: a system for automated detection of homologs
- UCSC Blat: a tool to quickly map sequences to genomes
- GeneCards: an integrated database of human gene information
- HSLS-licensed gene-centric databases:
-
ClusterMed: a tool to organize PubMed results into meaningful categories
Participants will learn how to answer questions like:
-
What are the disease causing genes for phenylketonuria?
-
How to identify a gene's promoter sequence?
-
From where can you order cDNA clones for human PAH gene?
-
What are the genomic coordinates for mouse muscle protein titin?
-
What is the mRNA reference sequence(s) for mouse SMN1 gene?
-
What is the chromosomal location of this 25 bp rat nucleotide sequence: GATGGGGCTGAGCTGGACTTGAACA?
This class is approved for AMA Category 2 CME credit.
If you have questions, contact the HSLS Molecular Biology Information Service:
Class PowerPoint Presentation
|
